Molecular Characterization and Evaluation of Indigenous Microbial Pathways Supporting Phenol Mineralization in Hydrocarbon-Polluted Soils of Gombe, Nigeria

Lanes IS, IVA, and OKA display amplified PCR products, with bands approximately 1,026 bp in size, confirming the successful amplification of the monooxygenase gene in these isolates. The three (3) isolates (IS, OKA and IVA) showed sharp band equivalent to that of mooxygenase gene with band length of 1,026 bp. Figure 2: Agarose Gel Electrophoresis of PCR-Amplified Mooxygenase Gene Gel Products. Lane L: Gene ruler 2 kb DNA ladder markers in bp, lane IS, IVA, and OKA (Approx. 1,026 bp). Figure 3 depicts the results of agarose gel electrophoresis for the hydroxylase gene amplification. Lane L contains the 0.4 kb DNA ladder, serving as a molecular weight reference. Lanes EB, EKA, and ONA show amplified PCR products with an approximate size of 209 bp, indicating successful amplification of the hydroxylase gene in these isolates. Isolates EB, EKA and ONA showed bands equivalent to that of hydroxylase gene with band length of 209bp. Figure 3: Agarose Gel Electrophoresis of PCR-Amplified Hydroxylase Gene Gel Products. Lane L: Gene ruler 0.4 kb DNA ladder markers in bp, lane EB, EKA, and ONA (Approx. 209 bp). P-ISSN 2695-222X The Partial 16S rRNA gene sequence of strain EB is: ATTCCAGACCCGAAGCACCGCGAGTGGGCCACTACAACAAGTGCTTCAACGGCT TGGAAGACTGGAACCATAAGCTGCGACCGGGGTGTCTGGTACCTGTCCGTGCCC AAGTCACTCGAACCAGTGGTTCGACCGTGTCTGGTACCTGTCCGTGCCCAAGTCT TTCTTCGAGGGGCATGCACAACTCGAACTTTCTTCGAGGGTCGGTACCTGTCCGT GCCCAAGTCTTTCTTGGAAGATGCCGGAACCCGGCCTTTCGAGTTCCTGATGGCC ATCAGCTTCTCCTTCGAGTACGGGGCGGGTACCG The partial hydroxylase phenol-degrading gene sequence of strain EB is: AGGCGGGTGGACAATGGGCGCAAGCCTGATCCAGCCATTCCGCGTGAGTGAAGA AGGCCTTCGGGTTGTAAAGCTCTTTCGCAAGGGAAGAAAACTTAGGCTCTAACAT ATTGAACGCTAGCGGGATGCTTTACACATGCAAGTCGAACGGCAGCGCGAGAGA GCTTGCTCTCTTGGCGGCGAGTGGCGGACGGGTGAGTAATATATCGGAACGTGC CCAGTAGCGGGGGATAACTACTCGAAAGAGTGGCTAATACCGCATACGCCCTAC GGGGGAAAGGGGGGGATCGCAAGACCTCTCACTATTGGAGCGGCCGATATCGGA TTAGCTAGTTGGTGGGGTAAAGGCTCACCAAGGCAACGATCCGTAGCTGGTTTG AGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAG GCAGCAGTGGGGAATTTTGGACAATGGGGGAAACCCTGATCCAGCCATCCCGCG TGTATGATGAAGGCCTTCGGGTTGTAAAGTACTTTTGGCAGAGAAGAAAAGGTA CTCCTAATACGAGNTACTGCTGACGGTATCTGCAGAATAAGCACCGGCTAACTAC GTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGG CGTAAAGCGTGTGTAGGCGAGCCTGAGGTTGACGGTACCTTGATAAGAAGCACC GGCTAACTACGTGCCAGCAGCCGCGGTAATACGTAGGGTGCGAGCGTTAATCGG AATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCAGATGTGAAATCC CCGAGCTCAACTTGGGAACTGCGTTTGAAACTACAAGACTAGAGTATGTCAGAG GGGGGTAGAATTCCATGTGTAGCAGTGAAATGCGCAGAGATGTGGAGGAATACC AATGGCGAAGGCAGCCCCCTGGGATAATATTGACGCTCATGCACGAAAGCGTGG AAACTCTAACA. The nucleotide sequence above was compared to those on the NCBI Gene Bank database. Strain EB exhibited 99. 8% 16S rRNA sequence identity with Alcaligenes faecalis and Alcaligenes phenolicus. More so, strain EB clusters most closely (97.22% sequence identity) with the other phenol degrading Alcaligenes strains indicating a strong functional and evolutionary relationship in their phenol-degrading gene sequences and the phylogenic trees were constructed using iTOL v7. The tree in Figure 4 shows the placement of Alcaligenes sp. EB among several Alcaligenes species, with Bordetella bronchiseptica serving as a more distant reference (or outgroups). The branch lengths (indicated by the scale bar) reflect inferred genetic distances. Notably, Alcaligenes sp EB clusters among known Alcaligenes faecalis and Alcaligenes phenolicus strains, demonstrating its close evolutionary relationship to these taxa based on their 16S rRNA gene sequences. P-ISSN 2695-222X Figure 4: 16S rRNA-Based Phylogenetic Tree of Strain EB within the Alcaligenes Genus The tree in Figure 5 illustrates the relationships among bacterial strains based on their multi- component hydroxylase phenol-degrading gene sequences. Two uncultured Marinobacterium isolates form one branch, while Pseudomonas aeruginosa, Sphingobium sp. X-b4, and Arthrobacter sp. W1 cluster separately. Alcaligenes sp. EB groups with other Alcaligenes strains, underscoring their close functional and evolutionary similarity in phenol degradation pathways. Figure 5: Phylogenetic Tree Illustrating the Hydroxylase Phenol-Degrading Gene Sequences of Strain EB among Diverse Bacterial Strains. The 16S rRNA gene analysis clearly places strain EB within the Alcaligenes genus (Figure 4), while phylogenetic examination of its phenol-degrading genes shows that they group most closely with those from other Alcaligenes strains (Figure 5). Consequently, strain EB has been provisionally designated as Alcaligenes sp. EB with an accession number of PV536963. P-ISSN 2695-222X Discussion In the current study, the six (6) phenol-degrading bacterial isolates (IS, OKA, IVA, EB, EKA, and ONA) that originated from the hydrocarbon-polluted soils of Gombe metropolis were examined for their molecular and functional characteristics. The results of the study are very important not only for understanding the genetic identity, the metabolic pathways and the phylogenetic relationships of the isolates but also for the phenol-contaminated environmental bioremediation in a wider context. The high levels of phenol in the soil over Gombe metropolis that were noted before by Lazarus et al. (2025) draw attention to the environmental stress due to industrial activities, automobile repairs, fuel handling and improper waste disposal. The presence of phenol is a serious problem due to its toxicity, persistence and potential for bioaccumulation up the food chain (Agency for Toxic Substances and Disease Registry, 2022; Zhang et al., 2011). The recovery of phenol- degrading bacteria from these soils further substantiates the idea that indigenous microbial communities acquire specialized metabolic capabilities through long-term exposure to pollutants, which is the case in the study of Basak et al. (2014). The successful amplification of the ~1500 bp 16S rRNA gene in all isolates is a clear indication that the genomic DNA extracted was pure and suitable for further molecular applications. The universal amplification of this gene is in agreement with the findings of previous studies which reported the gene's high conservation among bacterial taxa and its effectiveness for phylogenetic identification (Weisburg et al., 1991). Moreover, the presence of PCR bands that were sharp and well-defined imply that the isolates were indeed active and stable both metabolically and genetically during the whole processes of enrichment and cultivation. Differential amplification of the genes encoding monooxygenase and hydroxylase unveiled functional diversity of the isolates. The isolates IS, OKA, and IVA yielded the expected ~1026 bp fragments of the monooxygenase gene which is in line with their positive indole hydroxylation phenotype. Monooxygenases perform the first hydroxylation of phenol to catechol which is a critical rate-limiting step in phenol degradation (Shingler et al., 1992). The fact that this gene exists in these isolates suggests that they may be able to carry out phenol catabolism via monooxygenase-mediated ortho- or para-hydroxylation pathways, something that has been previously described in bacteria like Pseudomonas, Arthrobacter, and Enterobacter (Kanekar et al., 1999; Shebl et al., 2024). Conversely, the isolates EB, EKA, and ONA had the ~209 bp multi-component phenol hydroxylase gene fragment, implying their dependence on a multi-subunit hydroxylase system like those of organisms that thrive in phenol and cresol catabolism. Multi-component phenol hydroxylases exist in soil bacteria and are characterized by a broad substrate range, besides being highly efficient in the degradation of phenolic xenobiotics (Watanabe et al., 2002). The mPH-encoding microorganisms reported to be in contaminated habitats (Long et al., 2016; Hoyos-Hernandez et al., 2014) are the ones that the isolates’ ability to utilize phenol as a solitary carbon source agrees with. Amongst all the bacterial isolates, strain EB had the highest ability to degrade phenol and hence it was chosen for genetic sequencing. Its 16S rRNA sequence was found to be 99.8% identical to that of Alcaligenes faecalis and Alcaligenes phenolicus, therefore confirming its being part of the Alcaligenes genus. This is in line with the widely accepted knowledge on the biodegradation potential of Alcaligenes species, the majority of which can utilize not only phenolic compounds but also aromatic hydrocarbons (Basak et al., 2014). Phylogenetic studies using hydroxylase gene sequences also showed that strain EB is very near to other phenol degrading Alcaligenes strains. This very close relationship in evolutionary terms highlights the fact that catabolic pathways for aromatic degradation are conserved among such genera. EB being aligned with the taxa that have multi-component hydroxylase systems is in P-ISSN 2695-222X agreement with its phenotypic and molecular characteristics, as reported by Lazarus et al., (2025) and, therefore, its functional role in phenol mineralization is being supported. The detection of phenol-catabolizing genes in all six isolates reflects adaptive microbial responses to phenolic contamination in Gombe metropolis. The enrichment of bacteria capable of degrading phenol aligns with findings from similar hydrocarbon-impacted environments, where selective pressure favours organisms equipped with catabolic pathways for aromatic compounds (Zhang et al., 2011; Basak et al., 2014). Given the documented hazards of phenol including its toxicity, environmental persistence, and impact on soil and groundwater (Agency for Toxic Substances and Disease Registry, 2022; International Agency for Research on Cancer, 2020), the discovery of multiple indigenous phenol degraders presents promising opportunities for bioremediation. The diverse enzymatic pathways identified (monooxygenase and multi-component hydroxylase systems) suggest robust biodegradation potential across varying environmental conditions. Furthermore, the dominance of efficient degraders such as Alcaligenes sp. EB supports its potential application in bio-augmentation strategies aimed at restoring phenol-contaminated soils in the region. Conclusion This study demonstrates the presence of taxonomically and functionally diverse phenol- degrading bacteria in hydrocarbon-contaminated soils of Gombe metropolis. The molecular evidence confirms that isolates employ distinct catabolic strategies for phenol degradation, with strain EB emerging as a highly efficient degrader phylogenetically affiliated with known Alcaligenes species. The findings highlight the substantial natural bioremediation potential of indigenous microbial communities in mitigating phenolic pollution and provide a foundation for future applied bioremediation research. P-ISSN 2695-222X References Agency for Toxic Substances and Disease Registry. (2020). Toxicological profile for phenol. U.S. Department of Health and Human Services, Public Health Service. Agency for Toxic Substances and Disease Registry. (2022). Toxicological profile for phenol. U.S. Department of Health and Human Services. https://wwwn.cdc.gov/TSP/ToxProfiles/ToxProfiles.aspx?id=147&tid=27 Agency for Toxic Substances and Disease Registry. (2024). Toxicological profile for phenol. U.S. Department of Health and Human Services. Basak, S. P., Sarkar, P., & Pal, P. (2014). Isolation and characterization of phenol utilizing bacteria from industrial effluent-contaminated soil and kinetic evaluation of their biodegradation potential. Journal of Environmental Science and Health, Part A, 49(1), 67–77. https://doi.org/10.1080/10934529.2013.838870 Basha, K. M., Rajendran, A., & Thangavelu, V. (2010). Recent advances in the biodegradation of phenol: A review. Asian Journal of Experimental Biological Sciences, 1, 219–234. Bodalo, A., Gomez, J. L., Gomez, M., Leon, G., Hidalgo, A. M., & Ruiz, M. A. (2008). Phenol removal from water by hybrid processes: Study of the membrane process step. Desalination, 223, 323–329. https://doi.org/10.1016/j.desal.2007.01.203 Chitra, K., Prapap, M. R., & Kanchana, P. (1995). Phenol degradation by Pseudomonas pictorum isolated from industrial effluents. Journal of Environmental Science and Health, Part A, 30(6), 1207–1217. Ghadi, S. R., & Sangodhkar, A. A. (1995). Degradation of phenol by Pseudomonas cepacia. Journal of Applied Microbiology, 79(6), 722–726. https://doi.org/10.1111/j.1365- 2672.1995.tb00956.x Hoyos-Hernandez, C., Hoffmann, M., Guenne, A., & Mazeas, L. (2014). Elucidation of the thermophilic phenol biodegradation pathway via benzoate during the anaerobic digestion of municipal solid waste. Chemosphere, 97, 115–119. https://doi.org/10.1016/j.chemosphere.2013.11.030 Ibrahim, A., Musa, B., & Adamu, C. (2022). Assessment of phenol levels in Gombe metropolis water sources. Journal of Water and Environmental Science, 30(4), 200– 210. International Agency for Research on Cancer. (2020). IARC monographs on the identification of carcinogenic hazards to humans: Phenol. World Health Organization. https://monographs.iarc.who.int Kanekar, P. P., Desai, C. H., & Bhadbhade, B. J. (1999). Biodegradation of phenol by Pseudomonas putida. Environmental Microbiology, 1(3), 205–210. https://doi.org/10.1046/j.1462-2920.1999.00025.x Knezovich, J. P., Hirabayashi, J. M., Bishop, D. J., & Harrison, F. L. (1988). The influence of different soil types on the fate of phenol and its biodegradation products. Chemosphere, 17(10), 2199–2206. https://doi.org/10.1016/0045-6535(88)90159-5 Lazarus G. J., Ibrahim I. H., Abdulrasheed M., and Chinedu E. O (2024). Phenol Contamination and Microbial Diversity in Soil Samples from Mechanic Workshops in Gombe Metropolis: Implications for Bioremediation. Bima Journal of Science and Technology, 8(4B), 369-380. Letunic, I., & Bork, P. (2019). Interactive Tree of Life v4: Recent updates and new developments. Nucleic Acids Research, 47(W1), W256–W259. https://doi.org/10.1093/nar/gkz239 Loh, T. C., & Wang, H. L. (1998). Biodegradation of phenol by Pseudomonas putida strains isolated from industrial effluents. Journal of Industrial Microbiology & Biotechnology, 21(1), 21–27. P-ISSN 2695-222X Long, Y., Yang, S., Xie, Z., & Cheng, L. (2016). Cloning, expression, and characterization of catechol 1,2-dioxygenase from a phenol-degrading Candida tropicalis strain. Preparative Biochemistry and Biotechnology, 46, 673–678. https://doi.org/10.1080/10826068.2016.1163964 Mei, R., Zhou, M., Xu, L., Zhang, Y., & Su, X. (2019). Characterization of a pH-tolerant strain Cobetia sp. SASS1 and its phenol degradation performance under salinity conditions. Frontiers in Microbiology, 10, 2034. https://doi.org/10.3389/fmicb.2019.02034 Nordlund, I., Powlowski, J., & Shingler, V. (1990). Complete nucleotide sequence and polypeptide analysis of multicomponent phenol hydroxylase from Pseudomonas sp. strain CF600. Journal of Bacteriology, 172(12), 6826–6833. Prescott, L. M., Harley, J. P., & Klein, D. A. (2008). Microbiology (6th ed.). McGraw-Hill. Rosselló-Móra, R., Amils, R., & Rodríguez-Valera, F. (1994). Isolation and characterization of phenol-degrading bacteria from a wastewater treatment plant. Applied and Environmental Microbiology, 60(3), 941–948. Sambrook, J., Fritsch, E. F., & Maniatis, T. (1989). Molecular cloning: A laboratory manual (2nd ed.). Cold Spring Harbor Laboratory Press. Shebl, S., Ghareeb, D. A., Ali, S. M., Ghanem, N. B. E. D., & Olama, Z. A. (2024). Aerobic phenol degradation using native bacterial consortium via ortho- and meta-cleavage pathways. Frontiers in Microbiology, 15, 1400033. https://doi.org/10.3389/fmicb.2024.1400033 Shingler, V., Porter, S. C., & Jones, P. (1992). Characterization of mono- and multi- component phenol hydroxylase enzymes in phenol degradation. Journal of Bacteriology, 174(15), 4708–4714. U.S. Environmental Protection Agency. (2020). Underground storage tanks : Preventing and detecting releases. https://www.epa.gov/ust Usman, Z. M., Said, M. A., Shehu, F. A., Abdussalam, K., Abdulrazak, T. M., & Abdullahi, N. (2021). Isolation and identification of phenol-degrading bacteria from oil- contaminated sites. Nigerian Journal of Biotechnology, 38(1), 160–165. Watanabe, K., Sato, Y., & Nakajima, T. (2002). Cloning and sequencing of genes encoding phenol monooxygenases from phenol-degrading microorganisms. Journal of Molecular Microbiology and Biotechnology, 4(2), 157–165. Weisburg, W. G., Barns, S. M., Pelletier, D. A., & Lane, D. J. (1991). 16S ribosomal DNA amplification for phylogenetic study. Journal of Bacteriology, 173(2), 697–703. Zhang, X., et al. (2011). Phenolic compounds as environmental pollutants: Sources, toxicity, and microbial degradation. Environmental Science and Pollution Research, 18, 113– 120.